Fam135b^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Fam135b^{em1(IMPC)Rbrc}
• Name: family with sequence similarity 135, member B; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6148317
• Synonyms: Fam135b^em1Rbrc
• Gene: Fam135b Location: Chr15:71310800-71600282 bp, - strand Genetic Position: Chr15, 32.19 cM, cytoband D3
• Alliance: Fam135b^{em1(IMPC)Rbrc} page
• IMPC: Fam135b gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutations: Insertion, Intragenic deletion
• Mutation details: This allele was generated at RIKEN BioResource Research Center using D10A and guides with spacer sequences CTTCGTTTCTGTATAAGATC and TAAATGACGCCATGCTTTTC that targeted exon(s) ENSMUSE00000328014.2. This resulted in deletion(s) of 44 bp (location: Chr15:71404778-71404821; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Fam135b Mutation: 72 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)