About   Help   FAQ
Fam135bem1(IMPC)Rbrc
Endonuclease-mediated Allele Detail
Summary
Symbol: Fam135bem1(IMPC)Rbrc
Name: family with sequence similarity 135, member B; endonuclease-mediated mutation 1, RIKEN BioResource Center
MGI ID: MGI:6148317
Synonyms: Fam135bem1Rbrc
Gene: Fam135b  Location: Chr15:71310800-71600282 bp, - strand  Genetic Position: Chr15, 32.19 cM, cytoband D3
Alliance: Fam135bem1(IMPC)Rbrc page
IMPC: Fam135b gene page
Mutation
origin
Strain of Origin:  C57BL/6NTac
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutations:    Insertion, Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at RIKEN BioResource Center by injecting D10A RNA and 2 guide sequences CCGGAAAAGCATGGCGTCATTTA, CTTCGTTTCTGTATAAGATCTGG, which resulted in a Indel. (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Fam135b Mutation:  71 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory