Atp6v1g2^{em1(IMPC)Rbrc}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Atp6v1g2^{em1(IMPC)Rbrc}
• Name: ATPase, H+ transporting, lysosomal V1 subunit G2; endonuclease-mediated mutation 1, RIKEN BioResource Center
• MGI ID: MGI:6148314
• Synonyms: Atp6v1g2^em1Rbrc
• Gene: Atp6v1g2 Location: Chr17:35453910-35457743 bp, + strand Genetic Position: Chr17, 18.6 cM, cytoband B2
• Alliance: Atp6v1g2^{em1(IMPC)Rbrc} page
• IMPC: Atp6v1g2 gene page

Mutation origin

• Strain of Origin: C57BL/6NJcl
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at RIKEN BioResource Research Center using Cas9 and guides with spacer sequences CGGAGAAGGTGGCCGATGCC and GAGGAATCGGGAGCGCGTCC that targeted exon(s) ENSMUSE00000462778.6 ENSMUSE00000709938.2 ENSMUSE00000734642.2 ENSMUSE00000766194.2 ENSMUSE00001275870.2 ENSMUSE00001288649.2. This resulted in deletion(s) of 915 bp (location: Chr17:35455791-35456705; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 0 strains available Cell Lines: 0 lines available
• Carrying any Atp6v1g2 Mutation: 17 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)