About   Help   FAQ
Atp6v1e1em1(IMPC)Rbrc
Endonuclease-mediated Allele Detail
Summary
Symbol: Atp6v1e1em1(IMPC)Rbrc
Name: ATPase, H+ transporting, lysosomal V1 subunit E1; endonuclease-mediated mutation 1, RIKEN BioResource Center
MGI ID: MGI:6148313
Synonyms: Atp6v1e1em1Rbrc
Gene: Atp6v1e1  Location: Chr6:120772205-120799659 bp, - strand  Genetic Position: Chr6, 57.01 cM
Alliance: Atp6v1e1em1(IMPC)Rbrc page
IMPC: Atp6v1e1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJcl
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele from IMPC was generated at RIKEN BioResource Center by injecting CAS9 RNA and 2 guide sequences TTTGTAAACTTATGATCGTCCGG, CCCCTCCCTCGTGTACTCTATGC, which resulted in a Exon Deletion. (J:237616)
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 0 strains available      Cell Lines: 0 lines available
Carrying any Atp6v1e1 Mutation:  17 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/24/2026
MGI 6.24
The Jackson Laboratory