About   Help   FAQ
Htr3aem1.1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Htr3aem1.1(IMPC)J
Name: 5-hydroxytryptamine (serotonin) receptor 3A; endonuclease-mediated mutation 1.1, Jackson
MGI ID: MGI:6147798
Gene: Htr3a  Location: Chr9:48810513-48822399 bp, - strand  Genetic Position: Chr9, 26.53 cM
Alliance: Htr3aem1.1(IMPC)J page
IMPC: Htr3a gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThe conditional-ready parent allele was generated at The Jackson Laboratory by pronuclear injection of Cas9 RNA and 2 guide sequences TTTCTGACCCACTGTTATCG and GATGAAGAGAGGATACATCC, with plasmid donor Htr3a_Floxed exon 5, which contains exon 5 flanked by loxP and HindIII sites and 1kb homology arms. This produced a 2,513 bp knock-in beginning at Chromosome 9 negative strand position 48,905,948 bp GCTTCTGGTCACAGATGAG, and ending after AGTGGAGGGCTAGGAAAGGC at 48,903,515 bp (GRCm38/mm10). This knock-in added a single bp change C to G 5 bp before the addition of a 34 bp loxP site followed by a 6 bp HindIII restriction site (AAGCTT) to the 5-prime side of exon 5, 195 bp upstream (5-prime) of the exon, and a second single base pair C to G change 55 bp downstream (3-prime) of the exon, followed 5 bp later by another HindIII restriction site (AAGCTT) and a 34 bp loxP site. Subsequent Cre excision deleted all 170 bp of exon 5 as well as 240 bp of flanking intronic sequence for a total deletion of 410 bp. This deletion is predicted to cause a change of amino acid sequence after residue 130 and early truncation 16 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Htr3a Mutation:  37 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory