Htr3aem1.1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Htr3aem1.1(IMPC)J |
| Name: |
5-hydroxytryptamine (serotonin) receptor 3A; endonuclease-mediated mutation 1.1, Jackson |
| MGI ID: |
MGI:6147798 |
| Gene: |
Htr3a Location: Chr9:48810513-48822399 bp, - strand Genetic Position: Chr9, 26.53 cM
|
| Alliance: |
Htr3aem1.1(IMPC)J page
|
| IMPC: |
Htr3a gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: The conditional-ready parent allele was generated at The Jackson Laboratory by pronuclear injection of Cas9 RNA and 2 guide sequences TTTCTGACCCACTGTTATCG and GATGAAGAGAGGATACATCC, with plasmid donor Htr3a_Floxed exon 5, which contains exon 5 flanked by loxP and HindIII sites and 1kb homology arms. This produced a 2,513 bp knock-in beginning at Chromosome 9 negative strand position 48,905,948 bp GCTTCTGGTCACAGATGAG, and ending after AGTGGAGGGCTAGGAAAGGC at 48,903,515 bp (GRCm38/mm10). This knock-in added a single bp change C to G 5 bp before the addition of a 34 bp loxP site followed by a 6 bp HindIII restriction site (AAGCTT) to the 5-prime side of exon 5, 195 bp upstream (5-prime) of the exon, and a second single base pair C to G change 55 bp downstream (3-prime) of the exon, followed 5 bp later by another HindIII restriction site (AAGCTT) and a 34 bp loxP site. Subsequent Cre excision deleted all 170 bp of exon 5 as well as 240 bp of flanking intronic sequence for a total deletion of 410 bp. This deletion is predicted to cause a change of amino acid sequence after residue 130 and early truncation 16 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|