About   Help   FAQ
Tspan9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tspan9em1(IMPC)J
Name: tetraspanin 9; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6147563
Gene: Tspan9  Location: Chr6:127938359-128120541 bp, - strand  Genetic Position: Chr6, 62.73 cM
Alliance: Tspan9em1(IMPC)J page
IMPC: Tspan9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTAAAACCCTGAAAGCAGG, CCTGTAAAGCTGGTGACCCG, TCAGTGTTCAGTGAGACGAA and GCCTCGTCCCATTTACTGTA, which resulted in a 2472 bp deletion beginning at Chromosome 6 position 127,965,063 bp and ending after 127,967,534 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001254362, ENSMUSE00000197715, ENSMUSE00000197720, ENSMUSE00000197719, ENSMUSE00000239192 (exons 4, 5, 6, 7, and 8) and 1887 bp of flanking intronic sequence including the splice acceptors and donors. In addition there is an 8 bp deletion (CTGCTTTC) 70 bp after the 2472 bp deletion that will not affect the results of the deletion. This mutation is predicted to cause an in-frame deletion of 195 amino acids after amino acid residue 21 and retain the last 23 amino acids in-frame. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tspan9 Mutation:  146 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory