Ralgapa1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ralgapa1em1(IMPC)J |
| Name: |
Ral GTPase activating protein, alpha subunit 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6147545 |
| Gene: |
Ralgapa1 Location: Chr12:55649681-55867952 bp, - strand Genetic Position: Chr12, 24.06 cM
|
| Alliance: |
Ralgapa1em1(IMPC)J page
|
| IMPC: |
Ralgapa1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences AATTAAGTTCTTCAAAAGGC, TATGCTAAGGAGTAGTGAGA and TTTAGACAAATGCTAAATCA, which resulted in a 313 bp deletion beginning at Chromosome 12 position 55,794,879 bp and ending after 55,795,191 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000370584(exon 3) and 263 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp deletion (TGAG) 15 bp before the 313 bp deletion that will not alter the results of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 72 and early truncation 17 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|