About   Help   FAQ
Ralgapa1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ralgapa1em1(IMPC)J
Name: Ral GTPase activating protein, alpha subunit 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6147545
Gene: Ralgapa1  Location: Chr12:55649681-55867952 bp, - strand  Genetic Position: Chr12, 24.06 cM
Alliance: Ralgapa1em1(IMPC)J page
IMPC: Ralgapa1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 3 guide sequences AATTAAGTTCTTCAAAAGGC, TATGCTAAGGAGTAGTGAGA and TTTAGACAAATGCTAAATCA, which resulted in a 313 bp deletion beginning at Chromosome 12 position 55,794,879 bp and ending after 55,795,191 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000370584(exon 3) and 263 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp deletion (TGAG) 15 bp before the 313 bp deletion that will not alter the results of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 72 and early truncation 17 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ralgapa1 Mutation:  143 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory