Ecpasem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ecpasem1(IMPC)J |
| Name: |
Ecm29 proteasome adaptor and scaffold; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6147390 |
| Gene: |
Ecpas Location: Chr4:58798911-58912749 bp, - strand Genetic Position: Chr4, 32.35 cM
|
| Alliance: |
Ecpasem1(IMPC)J page
|
| IMPC: |
Ecpas gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGATGGGAACAGGTAAGCG, GCTTGGGCTTGTTTACCTGA, TTGGAAGCTGTAATAAACAG and ACATGTCAATTACTACTGCT, which resulted in a 289 bp deletion beginning at Chromosome 4 position 58,876,921 bp and ending after 58,877,209 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000527161 (exon 4) and 170 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 4 bp insertion (GAAT) and a 6 bp deletion (TAAACA)47 bp before the 289 bp deletion that will not alter the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 90 and early truncation 16 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|