Relchem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Relchem1(IMPC)J |
| Name: |
RAB11 binding and LisH domain, coiled-coil and HEAT repeat containing; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6143833 |
| Gene: |
Relch Location: Chr1:105591570-105682856 bp, + strand Genetic Position: Chr1, 49.64 cM, cytoband D
|
| Alliance: |
Relchem1(IMPC)J page
|
| IMPC: |
Relch gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGGCATCCAACCAAGAAAA, TGCGTTCACAAGTTTCATAA, GTAGTTTCTAAAATCAAAGC and TCAGGCTATAAAAAGTTACC, which resulted in a 696 bp deletion beginning at Chromosome 1 position 105,686,903 bp and ending after 105,687,598 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000370997, ENSMUSE00000385562, ENSMUSE00000348886 (exons 3,4,5) and 454 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (T) insertion and 7 bp deletion (ATAAAGG) 83 bp before the 696 bp deletion that will not affect the results of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 205 and early truncation 2 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|