About   Help   FAQ
Relchem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Relchem1(IMPC)J
Name: RAB11 binding and LisH domain, coiled-coil and HEAT repeat containing; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6143833
Gene: Relch  Location: Chr1:105591570-105682856 bp, + strand  Genetic Position: Chr1, 49.64 cM, cytoband D
Alliance: Relchem1(IMPC)J page
IMPC: Relch gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAGGCATCCAACCAAGAAAA, TGCGTTCACAAGTTTCATAA, GTAGTTTCTAAAATCAAAGC and TCAGGCTATAAAAAGTTACC, which resulted in a 696 bp deletion beginning at Chromosome 1 position 105,686,903 bp and ending after 105,687,598 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000370997, ENSMUSE00000385562, ENSMUSE00000348886 (exons 3,4,5) and 454 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a single bp (T) insertion and 7 bp deletion (ATAAAGG) 83 bp before the 696 bp deletion that will not affect the results of the mutation. This deletion is predicted to cause a change of amino acid sequence after residue 205 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Relch Mutation:  81 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory