Prss53^{em1(IMPC)Wtsi}
Endonuclease-mediated Allele Detail

Summary

• Symbol: Prss53^{em1(IMPC)Wtsi}
• Name: serine protease 53; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
• MGI ID: MGI:6140219
• Gene: Prss53 Location: Chr7:127485013-127490142 bp, - strand Genetic Position: Chr7, 69.81 cM
• Alliance: Prss53^{em1(IMPC)Wtsi} page
• IMPC: Prss53 gene page

Mutation origin

• Strain of Origin: C57BL/6N
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Wellcome Sanger Institute using Cas9 and guides with spacer sequences ATGAGAACGGGTATCAGGAC, CGTAACTGCCTGGCCCAGGT, GGCGGAAAAGCAGCTTTTAT, and GTTCTCGCTTGGCCACATCT that targeted exon(s) ENSMUSE00001240473.2 ENSMUSE00001244771.2 ENSMUSE00001253797.2 ENSMUSE00001262769.2 ENSMUSE00001274864.2 ENSMUSE00001284422.2 ENSMUSE00001291437.2 ENSMUSE00001307307.2 ENSMUSE00001310432.2 ENSMUSE00001312614.2 ENSMUSE00001737371.1 ENSMUSE00001737375.1. This resulted in deletion(s) of 1675 bp (location: Chr7:127487418-127489092; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Prss53 Mutation: 18 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)