About   Help   FAQ
Josd1em1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
Summary
Symbol: Josd1em1(IMPC)Wtsi
Name: Josephin domain containing 1; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute
MGI ID: MGI:6140206
Gene: Josd1  Location: Chr15:79558451-79572073 bp, - strand  Genetic Position: Chr15, 37.85 cM
Alliance: Josd1em1(IMPC)Wtsi page
IMPC: Josd1 gene page
Mutation
origin
Strain of Origin:  C57BL/6N
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation details:  This allele was generated at Wellcome Sanger Institute using Cas9 and guides with spacer sequences CATCAGGAGGGTCGATCTCC, CTACCCAAGAATCGCATGCC, CTGATTACTGTGTCTCAGAG, and TTCCTCCACTGTAATCCAGA that targeted exon(s) ENSMUSE00000126402.2 ENSMUSE00000126408.2 ENSMUSE00002190421.1. This resulted in deletion(s) of 3652 bp (location: Chr15:79558248-79561899; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Josd1 Mutation:  7 strains or lines available
References
Original:  J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/08/2026
MGI 6.24
The Jackson Laboratory