Dcnem1(IMPC)Wtsi
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Dcnem1(IMPC)Wtsi |
| Name: |
decorin; endonuclease-mediated mutation 1, Wellcome Trust Sanger Institute |
| MGI ID: |
MGI:6140184 |
| Gene: |
Dcn Location: Chr10:97315471-97354005 bp, + strand Genetic Position: Chr10, 50.27 cM
|
| Alliance: |
Dcnem1(IMPC)Wtsi page
|
| IMPC: |
Dcn gene page |
|
| Strain of Origin: |
C57BL/6N
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details:
This allele was generated at Wellcome Sanger Institute using Cas9 and guides with spacer sequences ACCTACAGTTAGATCAAAAC, CTTTGTCCAAACCTAGCAAA, TGTTTTATGATGCCGTCTTT, and TTGTTAGTGGCTACTTAATA that targeted exon(s) ENSMUSE00000099197.4. This resulted in deletion(s) of 15 bp (location: Chr10:97330859-97330873; GRCm39), 267 bp (location: Chr10:97330877-97331143; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)
|
|
|
|
|
| Original: |
J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8; |
| All: |
3 reference(s) |
|