Adprhl1^em1(IMPC)H
Endonuclease-mediated Allele Detail

Summary

• Symbol: Adprhl1^em1(IMPC)H
• Name: ADP-ribosylhydrolase like 1; endonuclease-mediated mutation 1, Harwell
• MGI ID: MGI:6140149
• Gene: Adprhl1 Location: Chr8:13271663-13304162 bp, - strand Genetic Position: Chr8, 5.73 cM
• Alliance: Adprhl1^em1(IMPC)H page
• IMPC: Adprhl1 gene page

Mutation origin

• Strain of Origin: C57BL/6NTac
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Modified isoform(s))
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at Medical Research Council Harwell using Cas9 and guides with spacer sequences AACAGACGTTCTCTTAGCCC, ACAGACGTTCTCTTAGCCCA, GTCAGTTCCTCACCTGGCAG, and TCAGTTCCTCACCTGGCAGA that targeted exon(s) ENSMUSE00000209613.4 ENSMUSE00000209616.4 ENSMUSE00001809952.1 ENSMUSE00001809956.1 ENSMUSE00001809960.1. This resulted in deletion(s) of 1087 bp (location: Chr8:13295298-13296384; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 3 strains available Cell Lines: 0 lines available
• Carrying any Adprhl1 Mutation: 57 strains or lines available

References

• Original: J:237616 MGI and IMPC, MGI Curation of Endonuclease-Mediated Alleles (CRISPR) from the International Mouse Phenotyping Consortium (IMPC). MGI Direct Data Submission. 2017-8
• All: 4 reference(s)