About   Help   FAQ
Mak16em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mak16em1(IMPC)J
Name: MAK16 homolog; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6140010
Gene: Mak16  Location: Chr8:31649496-31658752 bp, - strand  Genetic Position: Chr8, 18.05 cM
Alliance: Mak16em1(IMPC)J page
IMPC: Mak16 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTACACGACAATTTATAAA, GCAATTTTGCTTTTGCCCAA, GTTGCTGGAGCCTACAGTGA and TTCATGTTAGGGGACGAGCG, which resulted in a 392 bp deletion beginning at Chromosome 8 position 31,166,493 bp and ending after 31,166,884 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000210909 and ENSMUSE00000210910 (exons 2 and 3) and 232 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mak16 Mutation:  18 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory