Mak16^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Mak16^em1(IMPC)J
• Name: MAK16 homolog; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6140010
• Gene: Mak16 Location: Chr8:31649496-31658752 bp, - strand Genetic Position: Chr8, 18.05 cM
• Alliance: Mak16^em1(IMPC)J page
• IMPC: Mak16 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTACACGACAATTTATAAA, GCAATTTTGCTTTTGCCCAA, GTTGCTGGAGCCTACAGTGA and TTCATGTTAGGGGACGAGCG, which resulted in a 392 bp deletion beginning at Chromosome 8 position 31,166,493 bp and ending after 31,166,884 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000210909 and ENSMUSE00000210910 (exons 2 and 3) and 232 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 5 and early truncation 6 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Mak16 Mutation: 19 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)