Kcnv1^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Kcnv1^em1(IMPC)J
• Name: potassium channel, subfamily V, member 1; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6140006
• Gene: Kcnv1 Location: Chr15:44969680-44978316 bp, - strand Genetic Position: Chr15, 17.25 cM, cytoband D1
• Alliance: Kcnv1^em1(IMPC)J page
• IMPC: Kcnv1 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTAGTACTTTATAGATGGA, CCCTCCATCTATAAAGTACT, TCATAAGTAGGAAATCTGTC and CTTTCATATGTGCAAAATAT, which resulted in a 773 bp deletion beginning at Chromosome 15 position 45,112,795 bp and ending after 45,113,567 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000125700 (exon 2) and 243 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 157 and early truncation 12 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Kcnv1 Mutation: 41 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)