About   Help   FAQ
Samd11em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Samd11em1(IMPC)J
Name: sterile alpha motif domain containing 11; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6121489
Gene: Samd11  Location: Chr4:156331423-156340717 bp, - strand  Genetic Position: Chr4, Syntenic
Alliance: Samd11em1(IMPC)J page
IMPC: Samd11 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTGCAGTGGACCTTGAACG, TAGAGCTGCCCCGAGAGCAG, CCTACGGGAGCTTATCAGGG and CATCTTGGTGAGCAGGGCAT, which resulted in a 519 bp deletion beginning at Chromosome 4 position 156,250,058 bp and ending after 156,250,576 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001049485 (exon 5) and 356 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 106 and early truncation 19 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Samd11 Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory