About   Help   FAQ
Pcdhgb1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pcdhgb1em1(IMPC)J
Name: protocadherin gamma subfamily B, 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6120529
Gene: Pcdhgb1  Location: Chr18:37813325-37974923 bp, + strand  Genetic Position: Chr18, 19.55 cM
Alliance: Pcdhgb1em1(IMPC)J page
IMPC: Pcdhgb1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporation of Cas9 protein and 4 guide sequences TGGTCAACAGCGTCGCCTAA, ATTATCCTTCCCAATTCACA, GTGTGGCTAGCAAATCTTGC and TTTAGTGGAAGACGTGTCGT, which resulted in a 3032 bp deletion beginning at Chromosome 18 position 37,680,029 bp and ending after 37,683,060 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001339721 (exon 1) and 425 bp of flanking intronic sequence including the Kozak sequence and splice donor and is predicted to cause a null allele. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Pcdhgb1 Mutation:  80 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory