About   Help   FAQ
Tubb4bem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tubb4bem1(IMPC)J
Name: tubulin, beta 4B class IVB; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6120520
Gene: Tubb4b  Location: Chr2:25112172-25114714 bp, - strand  Genetic Position: Chr2, 17.08 cM, cytoband A3
Alliance: Tubb4bem1(IMPC)J page
IMPC: Tubb4b gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTCTTCCTTAATAGCCACC, AGGAAGGTCCAACTGACTGC, CCAGGGCGACGAATCCCTAA and GGTATCCAGGACGCAATGAA, which resulted in a 742 bp deletion beginning at Chromosome 2 position 25,223,727 bp and ending after 25,224,468 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000569385, ENSMUSE00000569384 (exons 3 and 4) and 522 bp of flanking intronic sequence including the splice acceptor and donor. In addition, there is a 2 bp insertion, GC, at the site of the deletion which will not alter the results of the 742 bp deletion. This deletion is predicted to cause a change of amino acid sequence after residue 19 and early truncation 27 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tubb4b Mutation:  15 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory