Tomm20em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Tomm20em1(IMPC)J |
Name: |
translocase of outer mitochondrial membrane 20; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6120515 |
Gene: |
Tomm20 Location: Chr8:127657417-127672594 bp, - strand Genetic Position: Chr8, 74.64 cM, cytoband E2
|
Alliance: |
Tomm20em1(IMPC)J page
|
IMPC: |
Tomm20 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by electroporation of Cas9 protein and 4 guide sequences CTAACAGAGCTTCTCAAACT, TTTGCTCTTACCACCACCAA, GTTCACTCGCCAGGGAGGCA and ACGTTTTGTAGAATTAATGA, which resulted in a 396 bp deletion beginning at Chromosome 8 position 126,940,940 bp and ending after 126,941,335 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000480474 (exon 2) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 2 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
4 reference(s) |
|