About   Help   FAQ
Tomm20em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tomm20em1(IMPC)J
Name: translocase of outer mitochondrial membrane 20; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6120515
Synonyms: Tomm20-
Gene: Tomm20  Location: Chr8:127657417-127672594 bp, - strand  Genetic Position: Chr8, 74.64 cM, cytoband E2
Alliance: Tomm20em1(IMPC)J page
IMPC: Tomm20 gene page
Tomm20em1(IMPC)J/Tomm20em1(IMPC)J mice exhibit embryonic lethality, with embryos recovered at E3.5 as blastocysts but not at E7.5. Blastocysts do not hatch from the zona pollucida or form outgrowths.

Show the 1 phenotype image(s) involving this allele.

Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by electroporation of Cas9 protein and 4 guide sequences CTAACAGAGCTTCTCAAACT, TTTGCTCTTACCACCACCAA, GTTCACTCGCCAGGGAGGCA and ACGTTTTGTAGAATTAATGA, which resulted in a 396 bp deletion beginning at Chromosome 8 position 126,940,940 bp and ending after 126,941,335 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000480474 (exon 2) and 349 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 40 and early truncation 2 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tomm20 Mutation:  20 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/29/2025
MGI 6.24
The Jackson Laboratory