About   Help   FAQ
H2-D1b-em5Dvs
Endonuclease-mediated Allele Detail
Summary
Symbol: H2-D1b-em5Dvs
Name: histocompatibility 2, D region locus 1; endonuclease-mediated mutation 5, David V Serreze
MGI ID: MGI:6119467
Gene: H2-D1  Location: Chr17:35482070-35486473 bp, + strand  Genetic Position: Chr17, 18.61 cM
Alliance: H2-D1b-em5Dvs page
Mutation
origin
Strain of Origin:  NOD/ShiLtDvs
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsCas9 and guide sequences GTACATCTCTGTCGGCTATG targeting H2-D1b and ATAATCCGAGATTTGAGCCG targeting H2-K1d were injected into NOD/ShiLtDvs embryos resulting in two deletions in exon 2, one 11 bp and one 3 bp, in addition to the single nucleotide deletion that is H2-K1em1Dvs. (J:257229)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 9 strains available      Cell Lines: 0 lines available
Carrying any H2-D1 Mutation:  51 strains or lines available
References
Original:  J:257229 Racine JJ, et al., Improved Murine MHC-Deficient HLA Transgenic NOD Mouse Models for Type 1 Diabetes Therapy Development. Diabetes. 2018 May;67(5):923-935
All:  5 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory