About   Help   FAQ
Tns2em1Nsas
Endonuclease-mediated Allele Detail
Summary
Symbol: Tns2em1Nsas
Name: tensin 2; endonuclease-mediated mutation 1, Nobuya Sasaki
MGI ID: MGI:6117704
Synonyms: Tns2deltaC
Gene: Tns2  Location: Chr15:102008848-102024836 bp, + strand  Genetic Position: Chr15, 57.29 cM
Alliance: Tns2em1Nsas page
Mutation
origin
Strain of Origin:  (C57BL/6 x DBA/2)F1
Mutation
description
Allele Type:    Endonuclease-mediated (Not Applicable)
Mutation:    Intragenic deletion
 
Mutation detailsExon 22 was targeted using an sgRNA (targeting AGAGACAGCCATTCATTCCAAGG) using CRISPR/Cas9 technology resulting in a 5 bp deletion (GRCm39:chr15:102022204_102022208delTTCCA) in the M3 founder line, creating a frame-shift and premature stop codon (p.F1168Rfs*48). Both the C-terminal Src homology (SH2) and phosphotyrosine binding (PTB) domains in the encoded peptide are affected. (J:244469)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Tns2 Mutation:  116 strains or lines available
References
Original:  J:244469 Marusugi K, et al., Functional validation of tensin2 SH2-PTB domain by CRISPR/Cas9-mediated genome editing. J Vet Med Sci. 2016 Oct 01;78(9):1413-1420
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/14/2024
MGI 6.23
The Jackson Laboratory