About   Help   FAQ
Dnajb5em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Dnajb5em1(IMPC)J
Name: DnaJ heat shock protein family (Hsp40) member B5; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6117091
Gene: Dnajb5  Location: Chr4:42949866-42959425 bp, + strand  Genetic Position: Chr4, 22.93 cM, cytoband B1
Alliance: Dnajb5em1(IMPC)J page
IMPC: Dnajb5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCATTTAGTGGCAGAGGGAA, CCTTTCTTATTCTGTCAGCG, ATGTACACGGGAAAAGACCA and ACACGGGAAAAGACCATGGC, which resulted in a 775 bp deletion beginning at Chromosome 4 positive strand position 42,956,466 bp and ending after 42,957,240 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001313254 (exon 3) and 173 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 71 and early truncation 11 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Dnajb5 Mutation:  16 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory