Zfp597^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Zfp597^em1(IMPC)J
• Name: zinc finger protein 597; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6115009
• Gene: Zfp597 Location: Chr16:3679408-3702241 bp, - strand Genetic Position: Chr16, 2.27 cM
• Alliance: Zfp597^em1(IMPC)J page
• IMPC: Zfp597 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTATGCCTTGTCCACACTGG, ATGGAACTTTCATCAGTTCT, CAAGCCATAGAGTTCCCCCA and TTTCGCCTTAGAATGCGGAG, which resulted in a 329 bp deletion beginning at Chromosome 16 negative strand position 3,871,404 bp and ending after 3,871,076 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001313389 (exon 2) and 202 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 11 and early truncation 11 amino acids later. (J:188991, J:384794)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Zfp597 Mutation: 22 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)