Coq3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Coq3em1(IMPC)J |
| Name: |
coenzyme Q3 methyltransferase; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6114793 |
| Gene: |
Coq3 Location: Chr4:21879673-21912162 bp, + strand Genetic Position: Chr4, 9.11 cM
|
| Alliance: |
Coq3em1(IMPC)J page
|
| IMPC: |
Coq3 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTATTGCAAATGATAAGCAA, GAGTTTCTTTGGGATAACAA, GAGTTTCTTTGGGATAACAA and CCAGTATGTTAAAGCTTATG, which resulted in a 559 bp deletion beginning at Chromosome 4 positive strand position 21,892,681 bp and ending after 21,893,239 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000340164 (exon 2) and 432 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 36 and early truncation 42 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|