About   Help   FAQ
Cep95em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cep95em1(IMPC)J
Name: centrosomal protein 95; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6111956
Gene: Cep95  Location: Chr11:106679466-106709687 bp, + strand  Genetic Position: Chr11, 70.02 cM
Alliance: Cep95em1(IMPC)J page
IMPC: Cep95 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTTGTCTCTTCTTCTCCAA, CCCCAAAGTGTGCAAACAGG, GGAAAGTCAAGAGCTCAGAA and GGAGGGACATTAGAGTATGC, which resulted in a 404 bp deletion beginning at Chromosome 11 positive strand position 106,799,857 bp and ending after 106,800,260 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000108594 (exon 5) and 304 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 123 and early truncation 22 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cep95 Mutation:  43 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
08/05/2025
MGI 6.24
The Jackson Laboratory