Cep95^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Cep95^em1(IMPC)J
• Name: centrosomal protein 95; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6111956
• Gene: Cep95 Location: Chr11:106679466-106709687 bp, + strand Genetic Position: Chr11, 70.02 cM
• Alliance: Cep95^em1(IMPC)J page
• IMPC: Cep95 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CCTTGTCTCTTCTTCTCCAA, CCCCAAAGTGTGCAAACAGG, GGAAAGTCAAGAGCTCAGAA and GGAGGGACATTAGAGTATGC, which resulted in a 404 bp deletion beginning at Chromosome 11 positive strand position 106,799,857 bp and ending after 106,800,260 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000108594 (exon 5) and 304 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 123 and early truncation 22 amino acids later. (J:188991, J:384794)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Cep95 Mutation: 45 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)