Dguok^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Dguok^em1(IMPC)J
• Name: deoxyguanosine kinase; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6111949
• Gene: Dguok Location: Chr6:83457199-83483887 bp, - strand Genetic Position: Chr6, 35.94 cM
• Alliance: Dguok^em1(IMPC)J page
• IMPC: Dguok gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCTTGGGAAACCACAAAGAC, AGACATGCACGCAGTCTAAT, GCAGCCAGTAACTTCTGCCA and TGCTTCCCAAATCCAGGTGA, which resulted in a 377 bp deletion retention of 3 bp (CAA)of endogenous sequence and further deletion of 26 bp, beginning at Chromosome 6 negative strand position 83,496,866 bp and ending after 83,496,461 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001273030 (exon 2) and 290 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 47 and early truncation 55 amino acids later. (J:188991)
• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

3 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Dguok Mutation: 12 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)