About   Help   FAQ
Stard9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Stard9em1(IMPC)J
Name: StAR related lipid transfer domain containing 9; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6111462
Gene: Stard9  Location: Chr2:120459602-120562376 bp, + strand  Genetic Position: Chr2, 60.37 cM, cytoband F1
Alliance: Stard9em1(IMPC)J page
IMPC: Stard9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCAGGAGAGACTAACAAAA, GGTGCTTTGTGGTAAGATGA, GCTAGTCCGGGGCAACCCAA and TTTCACGTCAGGGTCAGCAG, which resulted in a 453 bp deletion beginning at Chromosome 2 positive strand position 120,666,304 bp and ending after 120,666,756 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000167832 and ENSMUSE00000167830 (exons 5 and 6) and 358 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 17 bp deletion (GTCCGTCCCTTTTGTTA) 96 bp before the 453 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 117 and early truncation 19 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Stard9 Mutation:  190 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory