Stard9em1(IMPC)J
Endonuclease-mediated Allele Detail
|
Symbol: |
Stard9em1(IMPC)J |
Name: |
StAR related lipid transfer domain containing 9; endonuclease-mediated mutation 1, Jackson |
MGI ID: |
MGI:6111462 |
Gene: |
Stard9 Location: Chr2:120459602-120562376 bp, + strand Genetic Position: Chr2, 60.37 cM, cytoband F1
|
Alliance: |
Stard9em1(IMPC)J page
|
IMPC: |
Stard9 gene page |
|
Strain of Origin: |
C57BL/6NJ
|
Project Collection: |
IMPC
|
|
Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
Mutation: |
|
Intragenic deletion
|
|
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCAGGAGAGACTAACAAAA, GGTGCTTTGTGGTAAGATGA, GCTAGTCCGGGGCAACCCAA and TTTCACGTCAGGGTCAGCAG, which resulted in a 453 bp deletion beginning at Chromosome 2 positive strand position 120,666,304 bp and ending after 120,666,756 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000167832 and ENSMUSE00000167830 (exons 5 and 6) and 358 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 17 bp deletion (GTCCGTCCCTTTTGTTA) 96 bp before the 453 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 117 and early truncation 19 amino acids later.
(J:188991)
|
Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
All: |
2 reference(s) |
|