About   Help   FAQ
Uck2em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Uck2em1(IMPC)J
Name: uridine-cytidine kinase 2; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6111455
Gene: Uck2  Location: Chr1:167050464-167112657 bp, - strand  Genetic Position: Chr1, 74.61 cM
Alliance: Uck2em1(IMPC)J page
IMPC: Uck2 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACATCAATCAGAAAGGCCAG, TCCTGTCCACACATACCATA, AAAACGGTAAGACAGTGCCG and TATATTACTAGAGCTCAGGG, which resulted in a 709 bp deletion beginning at Chromosome 1 negative strand position 167,237,777 bp and ending after 167,237,069 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000160510 (exon 2) and 549 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 33 and early truncation 51 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Uck2 Mutation:  44 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory