Il2ra^em1Mson
Endonuclease-mediated Allele Detail

Summary

• Symbol: Il2ra^em1Mson
• Name: interleukin 2 receptor, alpha chain; endonuclease-mediated mutation 1, Alexander Marson
• MGI ID: MGI:6110563
• Synonyms: SNP
• Gene: Il2ra Location: Chr2:11647618-11698004 bp, + strand Genetic Position: Chr2, 8.91 cM, cytoband A2-A3
• Alliance: Il2ra^em1Mson page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Humanized sequence)
• Mutations: Insertion, Single point mutation
• Mutation details: CRISPR/Cas9 technology inserted an Il2ra intron 1 enhancer region guide RNA and Cas9 mRNA. The gRNA carries a C to T mutation associated with human inflammatory bowel disease (GAAGGAGGTATCTATTTTGGTCCC to GAAGGAGGTATTTATTTTGGTCCC) and Type 1 Diabetes (T1D). Expression of the Il2ra gene is not blocked, but in vitro gene activation in response to cell stimulation with anti-CD3/CD28 antibodies is delayed. (J:253576)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Il2ra Mutation: 51 strains or lines available

References

• Original: J:253576 Simeonov DR, et al., Discovery of stimulation-responsive immune enhancers with CRISPR activation. Nature. 2017 Sep 7;549(7670):111-115
• All: 1 reference(s)