Ppfia3^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ppfia3^em1(IMPC)J
• Name: protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6109981
• Gene: Ppfia3 Location: Chr7:44988550-45016443 bp, - strand Genetic Position: Chr7, 29.26 cM
• Alliance: Ppfia3^em1(IMPC)J page
• IMPC: Ppfia3 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTGCCACAGACAGAAAGGGC, GGAGCTTGCCACAGACAGAA, GATGAGGGATGGGTTAAGGA and GTTGAGTGAGACATGAAGGG, which resulted in a 824 bp deletion beginning at Chromosome 7 negative strand position 45,355,486 bp and ending after 45,354,663 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001273174, ENSMUSE1236795, ENSMUSE00001284496 (exons 11-13) and 549 bp of flanking intronic sequence including the splice acceptors and donors and is predicted to cause a change of amino acid sequence after residue 415 and early truncation 44 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ppfia3 Mutation: 47 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)