About   Help   FAQ
Wdr41em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Wdr41em1(IMPC)J
Name: WD repeat domain 41; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6109968
Gene: Wdr41  Location: Chr13:95112852-95159821 bp, + strand  Genetic Position: Chr13, 49.22 cM
Alliance: Wdr41em1(IMPC)J page
IMPC: Wdr41 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TAATACATACCAGTTCTACA, GGCCCAGTAGTTTTAAAGTC, TAAATGCTACAATTTTCAGT and TCTTTGTCAGCATTGACCAC, which resulted in a 391 bp deletion beginning at Chromosome 13 positive strand position 94,978,329 bp and ending after 94,978,719 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001262273 (exon 2) and 275 bp of flanking intronic sequence including the splice acceptor and donor. In addition, 96 bp before the 391 bp deletion there are 2 small intronic indels, a 5 bp (GTTGA) insertion followed 8 bp after that insertion by an 11 bp deletion (GTAGTTTTAAA) that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 17 and early truncation 6 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Wdr41 Mutation:  28 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory