Zpld1em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Zpld1em1(IMPC)J |
| Name: |
zona pellucida like domain containing 1; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6108892 |
| Gene: |
Zpld1 Location: Chr16:55045538-55118349 bp, - strand Genetic Position: Chr16, 33.65 cM
|
| Alliance: |
Zpld1em1(IMPC)J page
|
| IMPC: |
Zpld1 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CGCTGCTTAGAGGACCATAG, TGGTTCTGTTGATAGGAGCT, AGTGTGCACGTTATTAAGAG and ATAAAAGCACAGTAGAGGGC, which resulted in a 477 bp deletion beginning at Chromosome 16 negative strand position 55,251,842 bp and ending after 55,251,366 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000223414 (exon 4) and 256 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 10 bp deletion (CTATGGTCCT) 26 bp after the large deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 35 and early truncation 25 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|