About   Help   FAQ
Mettl6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Mettl6em1(IMPC)J
Name: methyltransferase 6, methylcytidine; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6108888
Gene: Mettl6  Location: Chr14:31195535-31216997 bp, - strand  Genetic Position: Chr14, 19.12 cM
Alliance: Mettl6em1(IMPC)J page
IMPC: Mettl6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTGGAGTGCTGCCTGGGCA, CTCACTAGTCATGTCCCCAC, AGAGCAACCATTCATAGTAA and GAATTAAAACACAGACCAGT, which resulted in a 390 bp deletion beginning at Chromosome 14 negative strand position 31,483,013 bp and ending after 31,482,624 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000121655 (exon 5) and 248 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 9 bp insertion at the 390 bp deletion site (AGTGAGTGA) and 4 bp deletion (TAGT) 37 bp before the 390 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 177 and early truncation 15 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 6 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Mettl6 Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory