Mettl6em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Mettl6em1(IMPC)J |
| Name: |
methyltransferase 6, methylcytidine; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6108888 |
| Gene: |
Mettl6 Location: Chr14:31195535-31216997 bp, - strand Genetic Position: Chr14, 19.12 cM
|
| Alliance: |
Mettl6em1(IMPC)J page
|
| IMPC: |
Mettl6 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTGGAGTGCTGCCTGGGCA, CTCACTAGTCATGTCCCCAC, AGAGCAACCATTCATAGTAA and GAATTAAAACACAGACCAGT, which resulted in a 390 bp deletion beginning at Chromosome 14 negative strand position 31,483,013 bp and ending after 31,482,624 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000121655 (exon 5) and 248 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 9 bp insertion at the 390 bp deletion site (AGTGAGTGA) and 4 bp deletion (TAGT) 37 bp before the 390 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 177 and early truncation 15 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|