About   Help   FAQ
Ube2iem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ube2iem1(IMPC)J
Name: ubiquitin-conjugating enzyme E2I; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6108121
Gene: Ube2i  Location: Chr17:25479482-25493856 bp, - strand  Genetic Position: Chr17, 12.53 cM
Alliance: Ube2iem1(IMPC)J page
IMPC: Ube2i gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 2 guide sequences ACTCAGAAACTCAATAGCAG and GGGCTTGTGAAAAACACTGT, which resulted in a 954 bp deletion beginning at Chromosome 17 negative strand position 25,269,032 bp and ending after 25,268,079 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000207073 (exon 5) and 844 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 74 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ube2i Mutation:  22 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory