About   Help   FAQ
Slc9a5em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Slc9a5em1(IMPC)J
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 5; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6107624
Gene: Slc9a5  Location: Chr8:106075475-106096513 bp, + strand  Genetic Position: Chr8, 53.04 cM
Alliance: Slc9a5em1(IMPC)J page
IMPC: Slc9a5 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGTAGGAGGGGGCCATACGG, TTCCTCCTAGTCCCCTGGGG, TTGAATGCAGGCCAAGTTGG and GCCTCCTCTGTCCCAAACGC, which resulted in a 205 bp deletion beginning at Chromosome 8 positive strand position 105,355,428 bp and ending after 105,355,632 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000355153 (exon 4) and 126 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 2 bp insertion (AG) at the deletion site that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 221 and early truncation 14 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Slc9a5 Mutation:  43 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory