Igsf9b^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Igsf9b^em1(IMPC)J
• Name: immunoglobulin superfamily, member 9B; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6107617
• Gene: Igsf9b Location: Chr9:27210500-27268842 bp, + strand Genetic Position: Chr9, 12.69 cM
• Alliance: Igsf9b^em1(IMPC)J page
• IMPC: Igsf9b gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ATTCGGAGCTAGCCAGACTG, CTCCATCTCTGTGATATACT, CCTCAAAGACTCACGTACAG and GGGCCGTGTACGCATACCTT, which resulted in a 636 bp deletion beginning at Chromosome 9 positive strand position 27,317,073 bp and ending after 27,317,708 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000967991 (exon 4) and 484 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 136 and early truncation 2 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Igsf9b Mutation: 69 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)