Retnlb^em1Lvh
Endonuclease-mediated Allele Detail

Summary

• Symbol: Retnlb^em1Lvh
• Name: resistin like beta; endonuclease-mediated mutation 1, Lora Hooper
• MGI ID: MGI:6105937
• Gene: Retnlb Location: Chr16:48637219-48639255 bp, + strand Genetic Position: Chr16, 30.75 cM, cytoband B5
• Alliance: Retnlb^em1Lvh page

Mutation origin

• Strain of Origin: C57BL/6J

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: Embryos were injected with guide RNA targeting exon 2 and Cas9 nuclease. Sequencing of several mice revealed an animal carrying the deletion of a single adenine nucleotide in this signal peptide coding region (CGTCTCCCTTCTCCCACTGATA -> CGTCTCCCTTCTCCCACTG*TA) which created a frameshift and premature stop codon. (J:250608)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 1 strain available Cell Lines: 0 lines available
• Carrying any Retnlb Mutation: 16 strains or lines available

References

• Original: J:250608 Propheter DC, et al., Resistin-like molecule beta is a bactericidal protein that promotes spatial segregation of the microbiota and the colonic epithelium. Proc Natl Acad Sci U S A. 2017 Oct 17;114(42):11027-11033
• All: 2 reference(s)