About   Help   FAQ
Retnlbem1Lvh
Endonuclease-mediated Allele Detail
Summary
Symbol: Retnlbem1Lvh
Name: resistin like beta; endonuclease-mediated mutation 1, Lora Hooper
MGI ID: MGI:6105937
Gene: Retnlb  Location: Chr16:48637219-48639255 bp, + strand  Genetic Position: Chr16, 30.75 cM, cytoband B5
Alliance: Retnlbem1Lvh page
Mutation
origin
Strain of Origin:  C57BL/6J
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsEmbryos were injected with guide RNA targeting exon 2 and Cas9 nuclease. Sequencing of several mice revealed an animal carrying the deletion of a single adenine nucleotide in this signal peptide coding region (CGTCTCCCTTCTCCCACTGATA -> CGTCTCCCTTCTCCCACTG*TA) which created a frameshift and premature stop codon. (J:250608)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Retnlb Mutation:  16 strains or lines available
References
Original:  J:250608 Propheter DC, et al., Resistin-like molecule beta is a bactericidal protein that promotes spatial segregation of the microbiota and the colonic epithelium. Proc Natl Acad Sci U S A. 2017 Oct 17;114(42):11027-11033
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory