Rbm6^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Rbm6^em1(IMPC)J
• Name: RNA binding motif protein 6; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6104257
• Gene: Rbm6 Location: Chr9:107650758-107750436 bp, - strand Genetic Position: Chr9, 59.07 cM, cytoband F1-F2
• Alliance: Rbm6^em1(IMPC)J page
• IMPC: Rbm6 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTTATTTGAAGGCACCAAC, TATGGCTCTTTGTCCACACA, CCAGCTGGCCAAGAATCACA and CTAATTTTTTATTTCCCTAC, which resulted in a 468 bp deletion beginning at Chromosome 9 negative strand position 107,847,543 bp and ending after 107,847,076 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001305293 (exon 5) and 398 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 471 and early truncation 27 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Rbm6 Mutation: 59 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)