About   Help   FAQ
Rbm6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Rbm6em1(IMPC)J
Name: RNA binding motif protein 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6104257
Gene: Rbm6  Location: Chr9:107650758-107750436 bp, - strand  Genetic Position: Chr9, 59.07 cM, cytoband F1-F2
Alliance: Rbm6em1(IMPC)J page
IMPC: Rbm6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGTTATTTGAAGGCACCAAC, TATGGCTCTTTGTCCACACA, CCAGCTGGCCAAGAATCACA and CTAATTTTTTATTTCCCTAC, which resulted in a 468 bp deletion beginning at Chromosome 9 negative strand position 107,847,543 bp and ending after 107,847,076 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001305293 (exon 5) and 398 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 471 and early truncation 27 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Rbm6 Mutation:  58 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/23/2024
MGI 6.23
The Jackson Laboratory