Tsga13^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Tsga13^em1(IMPC)J
• Name: testis specific gene A13; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6104246
• Gene: Tsga13 Location: Chr6:30873916-30892508 bp, - strand Genetic Position: Chr6, 12.54 cM
• Alliance: Tsga13^em1(IMPC)J page
• IMPC: Tsga13 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory using Cas9 and guides with spacer sequences AGAAGTTGAGGCGGTAACAA, CCTTTCCTCAACACGCAAGA, GTTAAGTTCCCAAACTTAAA, and TCCCAAGGAAAGATGACATA that targeted exon(s) ENSMUSE00000289889.2 ENSMUSE00001559449.1. This resulted in deletion(s) of 7 bp (location: Chr6:30889374-30889380; GRCm39), 357 bp (location: Chr6:30888953-30889309; GRCm39). This description was generated automatically. Additional molecular information including FASTA sequence support for this allele can be found here: (IMPC Gene page) and viewed in a genome context here: (IMPC Genome Browser). (J:384794)

• Inheritance: Not Specified

Expression

In Structures Affected by this Mutation:

1 anatomical structure(s)

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Tsga13 Mutation: 10 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 4 reference(s)