About   Help   FAQ
Tsga13em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Tsga13em1(IMPC)J
Name: testis specific gene A13; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6104246
Gene: Tsga13  Location: Chr6:30873916-30892508 bp, - strand  Genetic Position: Chr6, 12.54 cM
Alliance: Tsga13em1(IMPC)J page
IMPC: Tsga13 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AGAAGTTGAGGCGGTAACAA, TCCCAAGGAAAGATGACATA, GTTAAGTTCCCAAACTTAAA and CCTTTCCTCAACACGCAAGA, which resulted in a 357 bp deletion beginning at Chromosome 6 negative strand position 30,912,374 bp and ending after 30,912,018 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000289889 (exon 2) and 275 bp of flanking intronic sequence including the splice acceptor and donor. In addition, 64 bp before the exon deletion there is an indel consisting of a 4 bp insertion, ATAT, and a 7 bp deletion, CGCAAGA, that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 8 and early truncation 11 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Tsga13 Mutation:  9 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/22/2025
MGI 6.24
The Jackson Laboratory