Gm4792em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Gm4792em1(IMPC)J |
| Name: |
predicted gene 4792; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6102903 |
| Gene: |
Gm4792 Location: Chr10:94129527-94134565 bp, - strand Genetic Position: Chr10, 48.88 cM
|
| Alliance: |
Gm4792em1(IMPC)J page
|
| IMPC: |
Gm4792 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTTTACAAAGAGCAGGCCAC, GATTGCAGTGGCCTGAAGGC, GCTGCTGAGTCATATGTAGC and GCAGACTCCCATGACCATCA, which resulted in a 456 bp deletion beginning at Chromosome 10 negative strand position 94,295,355 bp and ending after 94,294,900 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000444933 (exon 2) and 338 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 49 and early truncation 8 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
3 reference(s) |
|