Gm12695^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gm12695^em1(IMPC)J
• Name: predicted gene 12695; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6101194
• Gene: Gm12695 Location: Chr4:96611884-96673423 bp, - strand Genetic Position: Chr4, 44.79 cM
• Alliance: Gm12695^em1(IMPC)J page
• IMPC: Gm12695 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences AACTCATTAGAAAAGTGCAG, TGAGCTGGTCAACATAACTG, ACCACTAATTACATCTCACA and CTCCTCATCATACACAACGC, which resulted in a 580 bp deletion beginning at Chromosome 4 negative strand position 96,769,948 bp and ending after 96,769,369 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000672016 (exon 2) and 345 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 13 bp insertion (CAAACTCACTGAT) at the deletion site and a 3 bp deletion (TTG) 5 bp after the exon deletion that are not predicted to affect the results of the deletion. This mutation is predicted to cause a change of amino acid sequence after residue 35 and early truncation 31 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gm12695 Mutation: 40 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)