Ttll7em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Ttll7em1(IMPC)J |
| Name: |
tubulin tyrosine ligase-like family, member 7; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6101191 |
| Gene: |
Ttll7 Location: Chr3:146558122-146689764 bp, + strand Genetic Position: Chr3, 72.28 cM, cytoband H3
|
| Alliance: |
Ttll7em1(IMPC)J page
|
| IMPC: |
Ttll7 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAAAACACAGCACTTGCAGA, ACAGTGTTCCAGGTGCAGAC, CCAGCGAGCAACGAGACAGG and ACACCTTAAGATGAGTGACA, which resulted in a 500 bp deletion beginning at Chromosome 3 positive strand position 146,896,502 bp and ending after 146,897,001 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000224812 (exon 4) and 378 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 5 bp deletion (CTCTG) 138 bp before the 500 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 52 and early truncation 12 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|