Ttll7^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Ttll7^em1(IMPC)J
• Name: tubulin tyrosine ligase-like family, member 7; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6101191
• Gene: Ttll7 Location: Chr3:146558122-146689764 bp, + strand Genetic Position: Chr3, 72.28 cM, cytoband H3
• Alliance: Ttll7^em1(IMPC)J page
• IMPC: Ttll7 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAAAACACAGCACTTGCAGA, ACAGTGTTCCAGGTGCAGAC, CCAGCGAGCAACGAGACAGG and ACACCTTAAGATGAGTGACA, which resulted in a 500 bp deletion beginning at Chromosome 3 positive strand position 146,896,502 bp and ending after 146,897,001 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000224812 (exon 4) and 378 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 5 bp deletion (CTCTG) 138 bp before the 500 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 52 and early truncation 12 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Ttll7 Mutation: 40 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)