About   Help   FAQ
Ttll7em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Ttll7em1(IMPC)J
Name: tubulin tyrosine ligase-like family, member 7; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6101191
Gene: Ttll7  Location: Chr3:146558122-146689764 bp, + strand  Genetic Position: Chr3, 72.28 cM, cytoband H3
Alliance: Ttll7em1(IMPC)J page
IMPC: Ttll7 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CAAAACACAGCACTTGCAGA, ACAGTGTTCCAGGTGCAGAC, CCAGCGAGCAACGAGACAGG and ACACCTTAAGATGAGTGACA, which resulted in a 500 bp deletion beginning at Chromosome 3 positive strand position 146,896,502 bp and ending after 146,897,001 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000224812 (exon 4) and 378 bp of flanking intronic sequence including the splice acceptor and donor. In addition there is a 5 bp deletion (CTCTG) 138 bp before the 500 bp deletion that will not alter the results of the exon deletion. This mutation is predicted to cause a change of amino acid sequence after residue 52 and early truncation 12 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Ttll7 Mutation:  40 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory