About   Help   FAQ
Srbd1em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Srbd1em1(IMPC)J
Name: S1 RNA binding domain 1; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6101175
Gene: Srbd1  Location: Chr17:86292093-86452603 bp, - strand  Genetic Position: Chr17, 56.51 cM, cytoband E4
Alliance: Srbd1em1(IMPC)J page
IMPC: Srbd1 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCCCTCTTTCACCTGTACA, TGACTATTTTAAGAGTAATG, ATAAACCTACTCATGTCATG and TCTGCTTTAGAATTAAAGGA, which resulted in a 294 bp deletion beginning at Chromosome 17 negative strand position 86,142,597 bp and ending after 86,142,304 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001033695 (exon 2) and 214 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence from the first amino acid and early truncation 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Srbd1 Mutation:  69 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory