About   Help   FAQ
Igsf9em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Igsf9em1(IMPC)J
Name: immunoglobulin superfamily, member 9; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6101173
Gene: Igsf9  Location: Chr1:172309355-172326445 bp, + strand  Genetic Position: Chr1, 79.86 cM
Alliance: Igsf9em1(IMPC)J page
IMPC: Igsf9 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACTTGGCCCATGACTACAAA, GAGAAACTGTATGTGCGGGA, CTGAGTTTAATTCAGCGCTG and CCAGTGTTAGGCAGTGACTG, which resulted in a 1163 bp deletion beginning at Chromosome 1 positive strand position 172,491,340 bp and ending after 172,492,502 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000361352 through ENSMUSE00000366373 (exons 7-9) and 590 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 224 and early truncation 18 amino acids later. (J:188991, J:384794)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Igsf9 Mutation:  43 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory