Clrn3em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Clrn3em1(IMPC)J |
| Name: |
clarin 3; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6094836 |
| Gene: |
Clrn3 Location: Chr7:135113195-135130383 bp, - strand Genetic Position: Chr7, 81.27 cM
|
| Alliance: |
Clrn3em1(IMPC)J page
|
| IMPC: |
Clrn3 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TATACCTGGAATGGACTCAG, ATGGGTGTCTATACCTGGAA, CACCAGGTGCAAAGACTTCT and CCAGAAGTCTTTGCACCTGG, which resulted in a 157 bp deletion beginning at Chromosome 7 negative strand position 135,518,605 bp and ending after 135,518,449 bp (GRCm38/mm10). This mutation creates an internal deletion of ENSMUSE00000341796 (exon 2) and is predicted to cause a change of amino acid sequence after residue 84 and a stop 108 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|