About   Help   FAQ
Pakapem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Pakapem1(IMPC)J
Name: paralemmin A kinase anchor protein; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6094831
Gene: Pakap  Location: Chr4:57434475-57896984 bp, + strand  Genetic Position: Chr4, 31.66 cM, cytoband C1
Alliance: Pakapem1(IMPC)J page
IMPC: Pakap gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATGGCTTTCGGTATCTGCT, AGACAACAGATGACACCTTT, CGTGCTGCGACTTTTCCCTG and TCCTAAATAGATACTGGTGT, which resulted in a 292 bp deletion beginning at Chromosome 4 negative strand position 57,648,243 bp and ending after 57,647,952 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001288752 (exon 3) and 161 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 10 amino acids later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 1 strain available      Cell Lines: 0 lines available
Carrying any Pakap Mutation:  4 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  1 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/30/2024
MGI 6.23
The Jackson Laboratory