Pakapem1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Pakapem1(IMPC)J |
| Name: |
paralemmin A kinase anchor protein; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:6094831 |
| Gene: |
Pakap Location: Chr4:57434475-57896984 bp, + strand Genetic Position: Chr4, 31.66 cM, cytoband C1
|
| Alliance: |
Pakapem1(IMPC)J page
|
| IMPC: |
Pakap gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences CATGGCTTTCGGTATCTGCT, AGACAACAGATGACACCTTT, CGTGCTGCGACTTTTCCCTG and TCCTAAATAGATACTGGTGT, which resulted in a 292 bp deletion beginning at Chromosome 4 negative strand position 57,648,243 bp and ending after 57,647,952 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001288752 (exon 3) and 161 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 42 and early truncation 10 amino acids later.
(J:188991, J:384794)
|
| Inheritance: |
|
Not Specified |
|
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
2 reference(s) |
|