Gpr150^em1(IMPC)J
Endonuclease-mediated Allele Detail

Summary

• Symbol: Gpr150^em1(IMPC)J
• Name: G protein-coupled receptor 150; endonuclease-mediated mutation 1, Jackson
• MGI ID: MGI:6094272
• Gene: Gpr150 Location: Chr13:76202970-76205115 bp, - strand Genetic Position: Chr13, 40.95 cM
• Alliance: Gpr150^em1(IMPC)J page
• IMPC: Gpr150 gene page

Mutation origin

• Strain of Origin: C57BL/6NJ
• Project Collection: IMPC

Mutation description

• Allele Type: Endonuclease-mediated (Null/knockout)
• Mutation: Intragenic deletion
• Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCCTAGAAGGCACTTTCAC, CAGGGCGGCGGTCTGGGGCG, TTCAGAATTGCGAGGCTGAA and ATGCGGGATTCAGAATTGCG, which resulted in a 1267 bp deletion beginning at Chromosome 13 negative strand position 76,056,814 bp and ending after 76,055,548 bp (GRCm38/mm10). This mutation causes an internal deletion of ENSMUSE00000362291 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and stop 4 amino acids later. (J:188991)
• Inheritance: Not Specified

Find Mice (IMSR)

• Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
• Carrying this Mutation: Mouse Strains: 2 strains available Cell Lines: 0 lines available
• Carrying any Gpr150 Mutation: 18 strains or lines available

References

• Original: J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012
• All: 3 reference(s)