About   Help   FAQ
Gpr150em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gpr150em1(IMPC)J
Name: G protein-coupled receptor 150; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6094272
Gene: Gpr150  Location: Chr13:76202970-76205115 bp, - strand  Genetic Position: Chr13, 40.95 cM
Alliance: Gpr150em1(IMPC)J page
IMPC: Gpr150 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TTCCTAGAAGGCACTTTCAC, CAGGGCGGCGGTCTGGGGCG, TTCAGAATTGCGAGGCTGAA and ATGCGGGATTCAGAATTGCG, which resulted in a 1267 bp deletion beginning at Chromosome 13 negative strand position 76,056,814 bp and ending after 76,055,548 bp (GRCm38/mm10). This mutation causes an internal deletion of ENSMUSE00000362291 (exon 1) and is predicted to cause a change of amino acid sequence after residue 4 and stop 4 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gpr150 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory