About   Help   FAQ
Trfem1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Trfem1(IMPC)J
Name: transferrin; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6094268
Gene: Trf  Location: Chr9:103086075-103107485 bp, - strand  Genetic Position: Chr9, 55.03 cM, cytoband F1-F3
Alliance: Trfem1(IMPC)J page
IMPC: Trf gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GTCAAACCAGAGGCGTATAG, GCAGGAAGAGGATCATTCCA, GCATCTCTCTAAGCAGCCCA and GATGAATCCGTTCGCCCCAA, which resulted in a 426 bp deletion beginning at Chromosome 9 negative strand position 103,228,289 bp and ending after 103,227,864 bp (GRCm38/mm10). This mutation deletes ENSMUSE00001246941 (exon 2) and 253 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 15 and early truncation 1 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Expression
In Structures Affected by this Mutation: 1 anatomical structure(s)
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Trf Mutation:  42 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory