About   Help   FAQ
Gpr137em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Gpr137em1(IMPC)J
Name: G protein-coupled receptor 137; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:6093478
Gene: Gpr137  Location: Chr19:6915425-6919818 bp, - strand  Genetic Position: Chr19, 5.09 cM
Alliance: Gpr137em1(IMPC)J page
IMPC: Gpr137 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GCCCTCTATACTGGACCAAG, TCTGCTGCCGTAACTGTCCC, TGACTCCTCAGGAGACCCCA and GTGAGGGCCGAGGGGATCCG, which resulted in a 841 bp deletion beginning at Chromosome 19 negative strand position 6,939,821 bp and ending after 6,938,981 bp (GRCm38/mm10). This mutation deletes ENSMUSE00000146635, ENSMUSE00000146628, ENSMUSE00000146634 (exons 3,4,5) and 505 bp of flanking intronic sequence including the splice acceptor and donor and is predicted to cause a change of amino acid sequence after residue 136 and read through the stop with a new stop 204 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Gpr137 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  3 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
04/07/2026
MGI 6.24
The Jackson Laboratory