About   Help   FAQ
Kcna6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Kcna6em1(IMPC)J
Name: potassium voltage-gated channel, shaker-related, subfamily, member 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5927763
Gene: Kcna6  Location: Chr6:126685292-126717610 bp, - strand  Genetic Position: Chr6, 61.72 cM
Alliance: Kcna6em1(IMPC)J page
IMPC: Kcna6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGATGCTCACCGAGGTTTGA, ATCGAGCTTATGCGGAGAAA, ATCGGAGAAATCCCTGACGC and GGAGAAATCCCTGACGCTGG, which resulted in an internal deletion beginning at Chromosome 6 negative strand position 126,739,902 bp and ending after 126,738,338 bp (GRCm38/mm10). This mutation deletes 1565 bp of ENSMUSE00000690877 (exon 1) and is predicted to cause a change of amino acid sequence after residue 7 with read through the stop to generate a later stop 54 amino acids later. (J:188991)
Inheritance:    Not Specified
Phenotypes
Loading...
View phenotypes and curated references for all genotypes (concatenated display).
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Kcna6 Mutation:  25 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  4 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory