Kcna6em1(IMPC)J
Endonuclease-mediated Allele Detail
|
|
| Symbol: |
Kcna6em1(IMPC)J |
| Name: |
potassium voltage-gated channel, shaker-related, subfamily, member 6; endonuclease-mediated mutation 1, Jackson |
| MGI ID: |
MGI:5927763 |
| Gene: |
Kcna6 Location: Chr6:126685292-126717610 bp, - strand Genetic Position: Chr6, 61.72 cM
|
| Alliance: |
Kcna6em1(IMPC)J page
|
| IMPC: |
Kcna6 gene page |
|
| Strain of Origin: |
C57BL/6NJ
|
| Project Collection: |
IMPC
|
|
| Allele Type: |
|
Endonuclease-mediated (Null/knockout) |
| Mutation: |
|
Intragenic deletion
|
| |
|
Mutation details: This allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences GGATGCTCACCGAGGTTTGA, ATCGAGCTTATGCGGAGAAA, ATCGGAGAAATCCCTGACGC and GGAGAAATCCCTGACGCTGG, which resulted in an internal deletion beginning at Chromosome 6 negative strand position 126,739,902 bp and ending after 126,738,338 bp (GRCm38/mm10). This mutation deletes 1565 bp of ENSMUSE00000690877 (exon 1) and is predicted to cause a change of amino acid sequence after residue 7 with read through the stop to generate a later stop 54 amino acids later.
(J:188991)
|
| Inheritance: |
|
Not Specified |
|
|
View phenotypes and curated references for all genotypes (concatenated display).
|
|
|
| Original: |
J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012; |
| All: |
4 reference(s) |
|