About   Help   FAQ
Cacng6em1(IMPC)J
Endonuclease-mediated Allele Detail
Summary
Symbol: Cacng6em1(IMPC)J
Name: calcium channel, voltage-dependent, gamma subunit 6; endonuclease-mediated mutation 1, Jackson
MGI ID: MGI:5927761
Gene: Cacng6  Location: Chr7:3472711-3484183 bp, + strand  Genetic Position: Chr7, 2.0 cM
Alliance: Cacng6em1(IMPC)J page
IMPC: Cacng6 gene page
Mutation
origin
Strain of Origin:  C57BL/6NJ
Project Collection: IMPC
Mutation
description
Allele Type:    Endonuclease-mediated (Null/knockout)
Mutation:    Intragenic deletion
 
Mutation detailsThis allele was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences TGCAAGAGGAAGACCGACGC, AGACCGACGCCGGACAGCTG, GGCGGATGTGCCCGCGGGCA and TGGCAGGCGGATGTGCCCGC, which resulted in a 311 bp internal deletion beginning at Chromosome 7 negative strand position 3,424,975 bp and ending after 3,424,665 bp (GRCm38/mm10). This mutation deletes 311 bp of ENSMUSE00001284940 (exon 1) and is predicted to cause a change of amino acid sequence after residue 1 and early truncation 1 amino acid later. (J:188991)
Inheritance:    Not Specified
Find Mice (IMSR)
Mouse strains and cell lines available from the International Mouse Strain Resource (IMSR)
Carrying this Mutation:  Mouse Strains: 2 strains available      Cell Lines: 0 lines available
Carrying any Cacng6 Mutation:  19 strains or lines available
References
Original:  J:188991 The Jackson Laboratory, Alleles produced for the KOMP project by The Jackson Laboratory. MGI Direct Data Submission. 2012;
All:  2 reference(s)

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory